Overview

Distribution

Endemic Range/ Yangtze River Basin

Silurus meridionalis is a demersal fish endemic to the middle Yangtze River. The upper Yangtze basin is considered the part from the headwaters to the Three Gorges area, or a catchment area of approximately one million square kilometers; this upper basin is quite mountainous. The most downstream element of the upper Yangtze basin is often termed the Sichuan Basin; here the Yangtze cuts through Triassic and Permian material before entering the Three Gorges. The Three Gorges area, generally regarded as the heart of the middle Yangtze, is a stretch of the river that runs approximately 660 kilometers, terminating at the site of the Three Gorges Dam.

There are several endemic benthopelagic fishes are found in the Yangtze, including: Anabarilius polylepis, Liobagrus kingi, Bangana rendahli, Pseudogyrinocheilus prochilus, and Sinocyclocheilus grahami; however, these benthopelagic endemics are generally found in the upper Yangtze basin.

  • C.Michael Hogan. 2012. Yangtze River. Encyclopedia of Earth. Topic ed. Peter Saundry. Ed.-in-chief Cutler J.Cleveland. National Council for Science and the Environment. Washington DC http://www.eoearth.org/article/Yangtze_River?topic=78166
  • Fishbase. 2010. Fish species in the Yangtze River Basin
Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Range Description

Recorded from the Yangtze River (Chang Jiang, and its tributary, the Xiang Jiang), the Pearl River (Bei Jiang) and the Min Jiang (Fujian Province) in southeastern China.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Asia: middle Yangtze River basin, China.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yangtze River basin, China.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

100.0 cm TL (male/unsexed; (Ref. 9417))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Yangtze River Demersal Habitat

This taxon is one of a number of demersal species in the Yangtze River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton.

The upper Yangtze basin consists chiefly of Paleozoic limestone and terrigenous sedimentary rock, with some granitic material. The most downstream element of the upper Yangtze basin is often termed the Sichuan Basin; here the Yangtze cuts through Triassic and Permian material before entering the Three Gorges. The Three Gorges area is a stretch of the Yangtze that runs approximately 660 kilometers, terminating at the site of the Three Gorges Dam. Prior to construction of the dam, the Three Gorges area was a site of exceptional natural beauty; after dam construction the gorge areas were filled with approximately 100 meters in depth of Yangtze water, and considerable amounts of the watershed were graded.

The lower Yangtze basin consists of anabranching river structures and Pleistocene coastal terraces. Prior to development of the Three Gorges Dam, the Yangtze Delta was replenished with a copious sediment load reaching the river mouth; however, the dam has now severely limited the natural flow and deposition of sediment to the delta region. Consequently, the integrity of the delta is been compromised, with scouring exceeding deposition, and the very stability of the delta is endangered.

Lower and middle basins of the Yangtze carry heavy pollutant loads. In the lower Yangtze basin nitrate levels are high, measuring at about 1000 tons per day at Datong; these levels accrue from high applications of chemical fertilizer applied and also considerable loadings of untreated sewage due to the large human population of the basin, with correspondingly little infrastructure for sewage treatment.

Heavy metal concentrations are also high in the lower Yangtze, with measurements of dissolved lead at 0.078 microgram/liter; cadmium (0.024 microgram/liter), chromium (0.57 microgram/liter), copper (1.9 microgram/liter), and nickel (0.50 microgram/liter). Levels of dissolved arsenic have been measured at 3.3 microgram/liter) and zinc at 1.5 microgram/liter), both notably higher by factors of 5.5 and 2.5 respectively than other typical large world rivers. In Yangtze River suspended sediment, arsenic comprises 31 microgram/gram, lead comprises 83 microgram/gram, and nickel comprises 52 micrograms/gram of sediment content

There are several large native demersal fish found in the Yangtze River, chiefly the 250 centimeter (cm) long endangered Yangtze sturgeon (Acipenser dabryanus), the 120 cm Chinese sturgeon (Acipenser sinensis), the 200 cm Giant mottled eel (Anguilla marmorata), the 122 cm black carp (Mylopharyngodon piceus), the 300 cm Chinese paddlefish (Psephurus gladius), and the 100 cm Silurus meridionalis. Furthermore, there are a few exceptionally large native benthopelagic fishes found in the Yangtze, namely, the 105 cm Silver carp (Hypophthalmichthys molitrix), the 200 cm Wuchang bream (Megalobrama amblycephala), the 200 cm yellowcheek (Elopichthys bambusa), the 145 cm common carp (Cyprinus carpio carpio), the 122 cm Mongolian redfin (Chanodichthys mongolicus), the 102 cm predatory carp (Chanodichthys erythropterus) and the 100 cm snakehead (Channa argus argus).. The demersal fish Silurus meridionalis also is found as a Yangtze River endemic species.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Found in rivers, moves within the river to spawning grounds. Carnivorous and hunts at night. Spawns from April to June in torrents (rapids) in sand and gravel. Lays sticky eggs.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Silurus meridionalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACAATCACGCGCTGATTTTTCTCAACTAACCATAAAGACATTGGCACCCTTTACCTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACAGCCTTAAGTCTCCTAATCCGAGCAGAGCTAGCCCAACCTGGCGCCCTCCTGGGTGATGATCAAATCTATAACGTCATCGTTACTGCTCACGCCTTTGTAATAATCTTCTTTATAGTAATACCAATTATGATCGGAGGATTTGGAAACTGGCTTGTACCCCTCATGATCGGGGCACCGGACATGGCCTTCCCCCGAATAAATAACATAAGCTTCTGGCTTCTCCCTCCCTCCTTCCTACTACTACTAGCCTCCTCTGGAGTTGAAGCAGGGGCAGGAACAGGGTGGACCGTTTACCCCCCTCTTGCAGGAAACCTTGCCCATGCAGGAGCTTCTGTAGATTTAACAATCTTTTCACTACATCTAGCAGGTGTGTCCTCTATTCTTGGAGCCATTAATTTCATTACAACTATCATTAACATGAAGCCCCCAGCCATCTCACAGTACCAAACACCTTTATTTGTGTGGGCCGTACTAATTACAGCAGTCCTTTTGCTCCTATCCCTGCCAGTCCTGGCCGCAGGGATCACAATACTTCTGACTGACCGAAACTTAAATACTACCTTCTTCGACCCGGCAGGGGGAGGAGATCCAATCCTTTACCAACATCTTTTCTGATTTTTCGGACACCCAGAAGTCTACATTCTGATTCTACCCGGATTTGGAATAATTTCTCATATTGTGGCCTACTATGCCGGTAAAAAAGAACCATTCGGCTACATGGGAATGGTCTGAGCTATAATGGCCATTGGTCTCCTAGGCTTCATCGTATGGGCCCATCACATATTCACAGTAGGAATAGACGTAGACACACGGGCATACTTTACATCCGCAACAATAATTATCGCAATCCCAACAGGGGTTAAAGTATTTAGCTGATTAGCCACCCTCCACGGAGGGTCTATTAAATGAGAAACGCCAATACTATGGGCTCTCGGGTTTATTTTCCTATTTACAGTTGGAGGGCTCACCGGAATTGTATTAGCCAACTCATCCCTAGATATTGTATTACATGACACCTACTATGTCGTAGCCCACTTTCACTACGTTCTATCGATGGGGGCCGTATTTGCAATCATAGGAGCTTTCGTTCACTGATTCCCCCTTTTTACAGGCTACACAATGCACGACACCTGAACAAAAATTCACTTTGGAACTATATTTGTAGGCGTAAATCTTACCTTCTTCCCCCAACACTTCCTAGGCCTAGCCGGAATACCACGGCGGTACTCAGACTACCCAGACGCATACTCACTATGAAATATTGTCTCGTCCATCGGCTCCTTAATCTCCCTAGTAGCAGTCGTAATATTCTTATATATCCTATGAGAAGCTTTCACCGCCAAACGAGAAGTACTCTCCGTTGAATTAACTGCCACAAACGTAGAATGACTGCACGGATGTCCTCCTCCCTACCACACATTTGAGGAACCAGCATTCGTACAAGTACAGACAAACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Silurus meridionalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Chen, X.-Y.

Reviewer/s
Allen, D., Zhao, H., Cui, K. & Zhou, W.

Contributor/s

Justification
Recorded from the Yangtze River (Chang Jiang and tributary), the Pearl River (Bei Jiang), and the Min Jiang (Fujian Province) in southeastern China. The species is impacted by overfishing and other threats, but at present it is assessed as Least Concern as the decline is not thought to be close to qualifying for a threatened category. However, the population should be monitored and the species reassessed if known threats have a greater impact than currently understood.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Decreasing in the wild. Larvae are propagated artificially for cultivation.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Overfishing and aquatic environment deterioration are a major threats factors. Changes to flow regimes as a result of dam construction would impact the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Research into populations trends, distribution, and threats is needed. The species is captive bred for aquaculture.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquaculture: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!