Overview

Distribution

Asia: upper Yellow River, China.
  • Kobayakawa, M. 1989 Systematic revision of the catfish genus Silurus, with description of a new species from Thailand and Burma. Jap. J. Ichthyol. 36(2):155-186. (Ref. 9417)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Changjiang [Yangtze] River, Zhujian [Pearl] River, Minjian, China.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 9417))
  • Kobayakawa, M. 1989 Systematic revision of the catfish genus Silurus, with description of a new species from Thailand and Burma. Jap. J. Ichthyol. 36(2):155-186. (Ref. 9417)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Silurus lanzhouensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACAATCACGCGCTGATTTTTCTCAACCAACCATAAAGACATTGGCACCCTTTACCTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACAGCCTTAAGTCTCCTAATCCGAGCAGAGCTAGCCCAACCTGGCGCCCTCCTAGGTGACGATCAAACCCATAACGTCATCGTTACTGCTCACGCCTTTGTAATAATCTTCTTTATAGTAATACCAATTATGATCGGAGGATTCGGAAACTGGCTTGTGCCCCTCATAATTGGGGCACCGGACATAGCCTTCCCCCGAACAAATAACATAAGCTTCTGGCTTCTTCCTCCTTCCTTCCTACTACTACTAGCCTCCTCTGGAGTTGAAGCGGGGGCAGGAACAGGGTGGACCGTTTACCCCCCTCTTGCAGGAAACCTTGCTCATGCAGGAGCTTCCGTAGATTTAACAATCTTTTCACTACATCTAGCAGGTGTGTCCTCCATTCTTGGAGCCATTAATCTCATTACAACTATCATTAACATGAAGCCCCCAGCCATCTCACAATACCAAACACCTTTATTTGTGTGGGCCGTACTAATTACAGCAGTCCTTATGCTCCTATCCCTGCCAGTCCTGGCCGCAGGGATCACAATACTTCTGACCGACCGAAACTTAAATACTACCTTCTTCGACCCGGCAGGGGGAGGAGACCCAATCCTTTACCAACATCTTTTCTGATTCTTCGGACACCCAGAAGCCTACATTCTGATTCTACCCGGATTTGGGATAATTTCTCATATTGTGGCCTACTATGCCGGTAAGAAAGAACCATTCGGCTACACGGGAATGGTCTGAGCTATAATGGCCATTGGTCTCCTAGGCTTCATCGTATGGGTCCATCACATATTCACAGTAGGAATAGACGTAGACACACGGGCATACTTTACATCCACAACAATAATTATCGCAATCCCAACAGGGGTTGAAGTATTTAGCTGATTAGCCACCCTCCACGGAGGGTCTATTAAATGAGAAACGCCAATACTATGGACTCTCGGATTTATTTTCCTATTTACAGTTGGAGGGCTCACCGGAATTGTATTAGCCAACTCATCCCTAGATATTGTATTACATGACACCTACTATGTCGTAGCCCACTTTCACTACGTTCTATCGATGGGGGCCGTATTTGCAATCATAGGAGCTTTCGTTCACTGATTCCCCCTTTTTACAGGCTACACAATGCACGACACCTGAACAAAAATTCACTTTGGAACTATATTTGTAGGCGTAAATCTTACCTTCTTTCCCCAACACTTCCTAGGCCTAGCCGGAATACCACGGCGGTACTCAGACTACCCAGACGCATACTCACTATGAAATATTGTCTCGTCCATCGGCTCCTTAATCTCCCTAGTAGCAGTCGTAATATTCTTATATATCCTATGAGAAGCTTCCACCGCCAAACGAGAAGTACTCTCCGTTGAATTAACTGCCACAAACGTAGAATGACTGCACGGATGTCCTCCTCCCTATCACACATTTGAGGGACCAGCATTCGTACAAGTACAGACAAACTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Silurus lanzhouensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!