Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Hides during the day and venture out at night to feed, tending to occur along steep drop-offs near caves on dark, moonless nights. Feeds on zooplankton. The large, deep water form is occasionally collected by fishing at depths of 200 to 400 m. Caught with cast nets in shallow waters of the Philippines. Forms aggregations (Ref 90102).
  • McCosker, J.E. and R.H. Rosenblatt 1987 Notes on the biology, taxonomy, and distribution of flashlight fishes (Beryciformes: Anomalopidae). Jap. J. Ichthyol. 34(2):157-164. (Ref. 5004)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific Ocean: Philippines and Indonesia to the Tuamoto Islands, north to southern Japan, south to the Great Barrier Reef.
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 7; Dorsal soft rays (total): 14 - 15; Analspines: 2; Analsoft rays: 9 - 11
  • Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 4538)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 350 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

35.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Characterized by dark grey color to nearly blackish with white margin on soft dorsal, anal, caudal and pelvic fins; lateral-line nearly straight; well developed and continuous midventral scutes; light organ turned off by rotating inward; large eye, 2.5-2.7 in head length; depth of body 3.0-3.3 in SL (Ref 90102).
  • Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 4538)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 400 m (Ref. 1602)
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 6 - 280
  Temperature range (°C): 17.969 - 27.219
  Nitrate (umol/L): 0.263 - 5.251
  Salinity (PPS): 34.289 - 35.557
  Oxygen (ml/l): 4.418 - 4.558
  Phosphate (umol/l): 0.225 - 0.505
  Silicate (umol/l): 2.657 - 3.898

Graphical representation

Depth range (m): 6 - 280

Temperature range (°C): 17.969 - 27.219

Nitrate (umol/L): 0.263 - 5.251

Salinity (PPS): 34.289 - 35.557

Oxygen (ml/l): 4.418 - 4.558

Phosphate (umol/l): 0.225 - 0.505

Silicate (umol/l): 2.657 - 3.898
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 400m.
From 2 to 400 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in inshore waters (Ref. 75154). Hides during the day and venture out at night to feed, tending to occur along steep drop-offs near caves on dark, moonless nights. Feeds on zooplankton (Ref. 5004).
  • McCosker, J.E. and R.H. Rosenblatt 1987 Notes on the biology, taxonomy, and distribution of flashlight fishes (Beryciformes: Anomalopidae). Jap. J. Ichthyol. 34(2):157-164. (Ref. 5004)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Deretrema Disease. Parasitic infestations (protozoa, worms, etc.)
  • Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anomalops katoptron

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTTTTCTCAACCAACCACAAAGACATTGGTACCCTGTATCTCGTATTCGGTGCATGAGCCGGCATGGTCGGCACAGCCCTAAGCCTTCTCATCCGAGCTGAGCTTAGTCAACCTGGGGCACTCTTAGGAGAT---GACCAGATTTACAATGTAATTGTTACAGCACATGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGTGGCTTTGGCAACTGATTGGTACCCCTAATGATTGGGGCTCCAGACATGGCATTCCCACGAATAAATAACATAAGCTTCTGACTTCTTCCCCCCTCTTTCCTTCTCCTTCTAGCCTCTTCCGGAGTTGAAGCAGGTGCCGGAACCGGATGAACCGTCTACCCACCCCTTGCGGGGAACCTCGCCCACGCAGGGGCCTCCGTAGACTTAACCATCTTCTCCCTACATCTTGCAGGTGTCTCTTCTATTCTGGGTGCCATTAATTTTATTACAACCATTATTAACATGAAGCCCCCTGCCATCTCCCAATACCAAACCCCACTATTTGTGTGAGCCGTATTAATTACAGCAGTCCTGCTTCTACTATCCCTTCCAGTCCTTGCAGCCGGCATCACAATACTCCTCACAGACCGAAACTTAAATACAACCTTCTTTGACCCTGCAGGGGGAGGCGATCCCATTCTGTACCAACACCTGTTCTGATTCTTCGGGCACCCCGAAGTATATATTCTTATCCTCCCAGGATTTGGCATGATCTCCCACATTGTCGCCTATTATTCCGGTAAAAAAGAACCATTCGGCTATATAGGAATGGTCTGAGCCATGATGGCTATCGGCCTACTCGGCTTTATTGTATGAGCCCATCACATGTTTACAGTCGGAATGGACGTAGACACGCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anomalops katoptron

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial; bait: occasionally
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
  • Paxton, J.R. and G.D. Johnson 1999 Anomalopidae. Flashlight fishes. p. 2212-2213. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 4. Bony fishes-part 2. (Mugilidae to Carangidae). FAO, Rome.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Splitfin flashlightfish

Anomalops katoptron, (splitfin flashlightfish or two-fin flashlightfish), is a species of flashlight fish found in the warm waters of the central and western Pacific Ocean where they are found in shallow waters in the vicinity of reefs and in deep waters from depths of 200 to 400 metres (660 to 1,310 ft).[1] This species grows to a length of 35 centimetres (14 in) TL. This species is the only known member of its genus. [2]

Physical description[edit]

Splitfin flashlightfish gets its name from its two glowing patches that are cause by bio-luminescent bacteria in organs below each eye. This fish have a black body with a blueish tint on their caudal and dorsal fins. This species grows to a length of 35 centimetres (14 in) TL. [3]

Behavior[edit]

These fish are nocturnal, emerging at night to feed on zooplankton and smaller fishes. [4]

In the aquarium[edit]

This fish can be found in the aquarium trade. It requires an aquarium of at least 125 gallons where it can be kept with other nocturnal fish including Pinecone Fish, Squirrelfish and Cardinalfish. This species requires plenty of hiding places and low lighting in the aquarium. [5]

References[edit]

  1. ^ Dianne J. Bray, 2011, Twofin Flashlightfish, Anomalops katoptron, in Fishes of Australia, accessed 07 Oct 2014, http://www.fishesofaustralia.net.au/home/species/3734
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2012). "Anomalops katoptron" in FishBase. October 2012 version.
  3. ^ http://fishindex.blogspot.com/2011/07/flashlight-fish-anomalops-katoptron.html
  4. ^ Froese, Rainer and Pauly, Daniel, eds. (2012). "Anomalops katoptron" in FishBase. October 2012 version.
  5. ^ http://fishindex.blogspot.com/2011/07/flashlight-fish-anomalops-katoptron.html
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!