Overview

Comprehensive Description

Biology

Found at the continental rise at depths from 2,525-3,931 m. Biology is unknown.
  • Iwamoto, T. 1990 Macrouridae. p. 192-206. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Southern Ocean: endemic.
  • Iwamoto, T. 1990 Macrouridae. p. 192-206. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Analspines: 0
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

60.0 cm TL (male/unsexed; (Ref. ))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; marine; depth range 2525 - 3931 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 3034.5 - 3722
  Temperature range (°C): 0.333 - 0.771
  Nitrate (umol/L): 32.876 - 33.249
  Salinity (PPS): 34.685 - 34.704
  Oxygen (ml/l): 4.836 - 5.139
  Phosphate (umol/l): 2.267 - 2.309
  Silicate (umol/l): 122.049 - 131.528

Graphical representation

Depth range (m): 3034.5 - 3722

Temperature range (°C): 0.333 - 0.771

Nitrate (umol/L): 32.876 - 33.249

Salinity (PPS): 34.685 - 34.704

Oxygen (ml/l): 4.836 - 5.139

Phosphate (umol/l): 2.267 - 2.309

Silicate (umol/l): 122.049 - 131.528
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coryphaenoides ferrieri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTATACCTTGTGTTTGGTGCCTGAGCCGGAATAGTGGGGACTGCCTTAAGTCTTCTCATCCGGGCCGAACTCAGCCAACCTGGCGCTCTTCTAGGGGACGATCAAATTTACAATGTTATTGTCACAGCACACGCATTTGTGATAATTTTTTTCATGGTTATACCTTTAATAATCGGAGGCTTCGGAAACTGACTTGTCCCCCTAATAATCGGGGCCCCTGATATGGCCTTTCCCCGAATAAATAATATAAGCTTCTGGCTCCTCCCCCCCTCATTCCTACTACTCCTAGCATCTTCTGGGGTCGAGGCGGGAGCCGGGACTGGGTGAACTGTCTACCCCCCTTTAGCGGGCAACCTTGCCCACGCAGGGGCATCCGTAGATTTAACAATCTTCTCCCTACATCTGGCTGGAATTTCCTCAATTTTAGGGGCAATTAATTTTATTACTACCATTATTAACATAAAGCCCCCAGCCATCACCCAGTATCAGACACCTTTGTTTGTATGAGCCGTGTTAATCACGGCTGTCCTCCTTTTACTGTCTCTTCCTGTATTAGCAGCTGGAATCACAATGCTGTTAACAGACCGAAACCTTAATACCTCCTTCTTCGACCCCGCGGGGGGAGGAGACCCCATCCTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Coryphaenoides ferrieri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!