Overview

Comprehensive Description

Biology

Found at the continental rise at depths from 2,525-3,931 m. Biology is unknown.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Southern Ocean: endemic.
  • Iwamoto, T. 1990 Macrouridae. p. 192-206. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Analspines: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

60.0 cm TL (male/unsexed; (Ref. ))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; marine; depth range 2525 - 3931 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 3034.5 - 3722
  Temperature range (°C): 0.333 - 0.771
  Nitrate (umol/L): 32.876 - 33.249
  Salinity (PPS): 34.685 - 34.704
  Oxygen (ml/l): 4.836 - 5.139
  Phosphate (umol/l): 2.267 - 2.309
  Silicate (umol/l): 122.049 - 131.528

Graphical representation

Depth range (m): 3034.5 - 3722

Temperature range (°C): 0.333 - 0.771

Nitrate (umol/L): 32.876 - 33.249

Salinity (PPS): 34.685 - 34.704

Oxygen (ml/l): 4.836 - 5.139

Phosphate (umol/l): 2.267 - 2.309

Silicate (umol/l): 122.049 - 131.528
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coryphaenoides ferrieri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTATACCTTGTGTTTGGTGCCTGAGCCGGAATAGTGGGGACTGCCTTAAGTCTTCTCATCCGGGCCGAACTCAGCCAACCTGGCGCTCTTCTAGGGGACGATCAAATTTACAATGTTATTGTCACAGCACACGCATTTGTGATAATTTTTTTCATGGTTATACCTTTAATAATCGGAGGCTTCGGAAACTGACTTGTCCCCCTAATAATCGGGGCCCCTGATATGGCCTTTCCCCGAATAAATAATATAAGCTTCTGGCTCCTCCCCCCCTCATTCCTACTACTCCTAGCATCTTCTGGGGTCGAGGCGGGAGCCGGGACTGGGTGAACTGTCTACCCCCCTTTAGCGGGCAACCTTGCCCACGCAGGGGCATCCGTAGATTTAACAATCTTCTCCCTACATCTGGCTGGAATTTCCTCAATTTTAGGGGCAATTAATTTTATTACTACCATTATTAACATAAAGCCCCCAGCCATCACCCAGTATCAGACACCTTTGTTTGTATGAGCCGTGTTAATCACGGCTGTCCTCCTTTTACTGTCTCTTCCTGTATTAGCAGCTGGAATCACAATGCTGTTAACAGACCGAAACCTTAATACCTCCTTCTTCGACCCCGCGGGGGGAGGAGACCCCATCCTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Coryphaenoides ferrieri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!