Overview

Comprehensive Description

Biology

Pantodon buchholzi is a creature from calm waters (Ref. 51626). It lives in swamps, creeks and backwaters (Ref. 31256), and inhabits the calmer parts of rivers (Ref. 41580), where it can be seen on the surface waters (Ref. 4910). They are capable to jump out of the water, to search for insects or to escape from predators (Ref. 2921). It is not a glider, but a ballistic jumper (Ref. 52282), with a tremendous jumping power (Ref. 31256). It is an exophageous insectivore, feeding on terrestrial insects and aquatic larvae and nymphs of insects (Ref. 41580). It also feeds on crustaceans and fish (Ref. 7020). Introduced in 1905 to European aquarists (Ref. 51626, Ref. 53207). Pantodon buchholzi is a favorite fish for aquarists; in the aquarium it can rest with the top of the head and the large pectoral fins touching the surface, while the long rays of the pelvic fin hang down perpendicularly, forming a tempting morsel for other aggressive fish in the same tank, and therefore it should be stocked together with only bottom dwellers (Ref. 13851). Observed maximum length of 15.0 cm TL in aquarium (Ref. 2921, Ref. 3515).
  • Teugels, G.G. 1990 Pantodontidae. p. 116-118. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome 1. Coll. Faune Trop. 28. Musée Royal de l'Afrique Centrale, Tervuren and Éditions de l'ORSTOM, Paris. 384 p. (Ref. 2921)   http://www.fishbase.org/references/FBRefSummary.php?id=2921&speccode=2075 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

West and Central Africa: Nigeria, Lake Chad, Cameroon, Ogowe basin, Congo basin and upper Zambezi River (Ref. 2921, Ref. 3515). Eastern limit of its distribution seems to be the Ouémé River in Benin (Ref. 1989, Ref. 3019), but it is also observed in Jong River, Sierra Leone (Ref. 2921).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is patchily distributed from Benin to Chad, and south to Gabon.

Central Africa: Pantodon buchholzi is known from Pool Malebo (Stanley Pool) upstream to Tanganga River, Lualaba River basin. Elsewhere, it is known from the Lower Guinea region from the Cross River (Nigeria), mouths of small coastal basins between the Cross and the Sanaga Rivers (Cameroon), and the southern part of the Ogowe (Gabon).

Western Africa: Specimens have been collected from Lower Cross Niger Delta (Imo and Osse) and Lower Ogun but the distribution seems to be much wider that this. Also reported from Lokoja near the confluence of the Benue and Niger, the Lower Benue, Chari in the Chad basin, and Lower Oueme in Benin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

West-central Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 6; Analspines: 0; Analsoft rays: 9 - 15
  • Teugels, G.G. 1990 Pantodontidae. p. 116-118. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome 1. Coll. Faune Trop. 28. Musée Royal de l'Afrique Centrale, Tervuren and Éditions de l'ORSTOM, Paris. 384 p. (Ref. 2921)   http://www.fishbase.org/references/FBRefSummary.php?id=2921&speccode=2075 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

11.9 cm TL (male/unsexed; (Ref. 52030))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Compressed body, flattened on the dorsal side and head, careened on the ventral side behind the pelvic fins (Ref. 2921, Ref. 13851). Large mouth, with numerous teeth and a prominent lower jaw (Ref. 2921), upwardly directed (Ref. 3054, Ref. 42873). Short dorsal fin placed very posterior on the back (Ref. 2921), inserted behind the longer anal fin (Ref. 3054, Ref. 13851). Large development of the pectoral fins (Ref. 2921, Ref. 3054), enlarged and wing-like (Ref. 42873). Very advanced position of the pelvic fins, with 4 elongated, filamentous rays (Ref. 2921, Ref. 3054). The caudal fin is long, pointed and rather ragged, with the two centre rays the longest (Ref. 13851). Large cycloid scales (Ref. 2921), subcircular, with rounded but evident laterobasal angles (Ref. 53264): 26-30 lateral line scales, 21-26 predorsal scales (Ref. 52030, Ref. 52046). Extremely brilliant colored (Ref. 2921): dorsal side of the body olive-colored, ventral side silvery yellow amplified with carmine; sometimes with darker transversal bands on the back (Ref. 2921, Ref. 3032). The fins are vivid pink-colored with small brown-violet spots, forming transversal bands on the pectoral fins, and tinted with violet on the inside and extremities (Ref. 2921).
  • Teugels, G.G. 1990 Pantodontidae. p. 116-118. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome 1. Coll. Faune Trop. 28. Musée Royal de l'Afrique Centrale, Tervuren and Éditions de l'ORSTOM, Paris. 384 p. (Ref. 2921)   http://www.fishbase.org/references/FBRefSummary.php?id=2921&speccode=2075 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic; potamodromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Pantodon buchholzi is a pelagic, potamodromous species. It is a species from calm waters (White 1994). It lives in swamps, creeks and backwaters (Olaosebikan and Raji 1998), and inhabits the calmer parts of rivers (Matthes 1964), where it can be seen on the surface waters (Gosse 1963). They are capable of jumping out of the water, to search for insects or to escape from predators (Teugels 1990). It is not a glider, but a ballistic jumper (Saidel et al. 2004), with a tremendous jumping power (Olaosebikan and Raji 1998). Pantodon buchholzi is an exophageous insectivore, feeding on terrestrial insects and aquatic larvae and nymphs of insects (Matthes 1964). It also feeds on crustaceans and fish (Mills and Vevers 1989). It was introduced in 1905 to European aquarists (White 1994, Arnold 1935). Pantodon buchholzi is a favourite fish for aquarists; in the aquarium it can rest with the top of the head and the large pectoral fins touching the surface, while the long rays of the pelvic fin hang down perpendicularly, forming a tempting morsel for other aggressive fish in the same tank, and therefore it should be stocked together with only bottom dwellers (Reed et al. 1967). Pantodon buchholzi lays 80 to 220 eggs (Riehl and Baensch 1996).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

It lives in swamps, creeks and buckwaters (Ref. 31256), and inhabiting the calmer parts of the rivers (Ref. 41580). It can leap out of the water. Exophageous insectivore, mainly feeding on terrestrial insect and aquatic larvae and nymphs of insects (Ref. 41580). Feeds also on crustaceans and fish (Ref. 7020).
  • Teugels, G.G. 1990 Pantodontidae. p. 116-118. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome 1. Coll. Faune Trop. 28. Musée Royal de l'Afrique Centrale, Tervuren and Éditions de l'ORSTOM, Paris. 384 p. (Ref. 2921)   http://www.fishbase.org/references/FBRefSummary.php?id=2921&speccode=2075 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Fin Rot (early stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aeromonosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

It lays 80 to 220 eggs (Ref. 13371). The eggs have a diameter of about 1.5 mm (Ref. 41580).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pantodon buchholzi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACAATAACACGCTGATTATTTTCAACCAACCATAAAGACATCGGCACTCTATATTTAGTATTCGGGGCCTGAGCCGGAATAGTGGGCACTGCCCTCAGCCTGTTAATCCGAGCCGAACTAAGCCAACCTGGAGCTTTATTAGGGGACGACCAGATTTATAATGTCATCGTGACGGCACACGCCTTCGTGATGATTTTTTTTATAGTTATACCAATTATAATCGGAGGCTTCGGTAACTGATTAGTACCTTTAATAATCGGGGCCCCAGACATAGCCTTCCCTCGCATAAATAATATAAGTTTTTGACTACTCCCTCCGTCCTTTCTTCTCTTATTAGCATCTTCTGGTGTAGAAGCAGGTGCCGGAACAGGATGAACAGTCTACCCACCACTGGCAGGCAACCTTGCACATGCCGGTGCTTCTGTTGATTTAACTATTTTTTCACTACACTTAGCTGGTGTATCTTCTATTTTAGGGGCTATTAATTTTATTACTACTATTATTAATATAAAACCACCAGCTATTTCACAATACCAGACCCCATTATTCGTATGGTCCGTCTTAGTAACAGCTGTCCTACTTTTATTATCGCTACCAGTACTTGCTGCAGGCATTACAATACTACTCACAGACCGTAATTTAAACACCACATTCTTCGATCCTGCTGGTGGTGGAGACCCAATTCTCTACCAACACTTATTTTGATTCTTTGGCCACCCAGAAGTCTATATTCTAATCCTCCCAGGTTTTGGAATAATCTCTCACATTGTTGCCTACTACTCTGGTAAAAAAGAACCATTTGGATATATAGGAATAGTCTGAGCCATAATAGCCATTGGACTATTAGGTTTTATTGTATGAGCCCATCACATGTTTACAGTCGGCATAGATGTAGACACCCGCGCTTATTTTACATCAGCAACCATGATTATTGCTATCCCAACAGGGGTAAAAGTATTTAGCTGACTTGCCACTTTACATGGCGGGTCTATTAAATGAGATACACCTATGCTTTGAGCACTAGGTTTTATCTTTTTATTTACTGTAGGGGGATTAACTGGCATTATTCTAGCCAACTCATCCCTAGATATTGTATTACACGACACATACTATGTTGTAGCACACTTCCATTATGTACTATCTATGGGAGCTGTCTTTGCCATTATAGGCGGGTTTGTACACTGATTCCCATTATTTTCAGGATATACTCTACACAATACATGAACAAAAATTCATTTCGGAGTAATATTTATTGGTGTTAATCTAACATTTTTCCCTCAACATTTTTTAGGCCTAGCAGGTATACCACGACGATACTCTGATTACCCTGACGCTTACACTTTATGAAACACAGTTTCTTCTATTGGATCTTTAATTTCACTTGTAGCAGTAATTATATTTTTATTTATTCTGTGAGAGGCATTCGTAGCTAAACGAGAAGTTTTATCAGTAGAGCTGACTCACACAAATGTCGAATGACTGAACGGTTGCCCTCCCCCATACCATACATTTGAAGAACCAGCTTTCGTACAAGTCCAAACAAAACGAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pantodon buchholzi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Moelants, T.

Reviewer/s
Brummett, R., Mbe Tawe, A.N., Dening Touokong, C., Reid, G.M., Snoeks, J. Staissny, M., Moelants, T., Mamonekene, V., Ndodet, B., Ifuta, S.N.B., Chilala, A., Monsembula, R., Ibala Zamba, A., Opoye Itoua, O., Pouomogne, V., Darwall, W. & Smith, K.

Contributor/s

Justification
This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for central and western Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No information available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
It has commercial value as an aquarium fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Freshwater butterflyfish

The freshwater butterflyfish or African butterflyfish, Pantodon buchholzi, is the only species in the family Pantodontidae within the Order Osteoglossiformes. It is not closely related to saltwater butterflyfishes.

Contents

Description and habits [edit]

Freshwater butterfly fish are small, no more than 13 centimetres (5.1 in) in length, with very large pectoral fins. It has a large and well-vascularized swim bladder, enabling it to breathe air at the surface of the water. They are carnivorous, feeding primarily on aquatic insects and smaller fishes.Greenwood, P.H. & Wilson, M.V. (1998). In Paxton, J.R. & Eschmeyer, W.N. Encyclopedia of Fishes. San Diego: Academic Press. p. 81. ISBN 0-12-547665-5. 

The freshwater butterflyfish is a specialized surface hunter. Its eyes are constantly trained to the surface and its upturned mouth is specifically adapted to capture small prey along the water's surface. If enough speed is built up in the water, a butterflyfish can jump and glide a small distance above the surface to avoid predation. It also wiggles its pectoral fins as it glides, with the help of specialized, enlarged pectoral muscles, the ability which earned the fish its common name.Berra, Tim M. (2001). Freshwater Fish Distribution. San Diego: Academic Press. ISBN 0-12-093156-7

When freshwater butterflyfish spawn, they produce a mass of large floating eggs at the surface. Fertilisation is believed to be internal. Eggs hatch in approximately seven days.

Distribution [edit]

Freshwater butterflyfish are found in the slightly acidic standing bodies of water in West Africa. They require a year round temperature of 73-86°F. Butterflyfish are found in slow to no current areas with high amounts of surface foliage for cover. They are commonly seen in Lake Chad, the Congo Basin, throughout Lower Niger, Cameroon, Ogooue, and Upper Zambezi. They have also been seen in the Niger Delta, Lower Ogun, and in the Lower Cross River.

In the aquarium [edit]

Freshwater Butterflyfish are kept as pets in an aquarium of at least 30 gallons - about 115 liters - although a single specimen should be kept in that size as the only top-level fish, as they can be aggressive to their own kind and others at surface level. The tops of the tanks have to be tightly closed because of their jumping habits. They also prefer a tank with live plants, especially ones that float near the surface, providing hiding places to reduce stress. They require a pH of 6.9-7.1, and a KH of 1-10. In aquaria, Freshwater Butterflyfish can grow to 5 inches. Freshwater Butterflyfish should not be kept with fin-eating or aggressive fish. They eat any fish small enough to fit in their mouths, so they should be maintained with bottom-dwelling fish or top- and mid- dwelling fish too large in size to be bothered by it. They generally will not eat prepared food, and do best on a diet of live or possibly canned crickets and other insects, as well as live, gut-loaded feeder fish (Goldfish should be avoided). They prefer still water, so filtration should not be too powerful.

References [edit]

See also [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!