Overview

Brief Summary

Biology

This herbivorous fish uses its strong beak-like mouthparts to scrape algae and other plant matter from the surface of the coral (4). This maintains the health of the reef by keeping algae in check, which could otherwise overwhelm the delicate reef ecosystem (5). An unusual feature of parrotfishes is that they are able to change sex, with females becoming fully functional males (4). In a population, rainbow parrotfish start off as either females or males (known as primary males). Females may at some point in their life become male (secondary males). Populations that have these two types of males are called 'diandrous', meaning 'two-males' (4). A terminal phase male defends a territory and a harem of females. If the male should die, the most dominant female will become the dominant male, her ovaries becoming functional male testes (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The rainbow parrotfish is the largest herbivorous fish in the Atlantic (3), with males growing to lengths of 1.2 metres (2). As the name suggests, they are attractively coloured fish with deep green bodies. The fins are orange with streaks of green extending outwards towards the back and tail (2). There are two forms of males; 'initial phase' males are drab in colour and similar in appearance to females, whereas 'terminal phase' males are brightly coloured (4). Parrotfish are so-called because of their unusual mouthparts. The teeth are fused to form a tough parrot-like beak which is used to scrape algae and other organic matter from the surface of coral (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabits coral reefs. Young are commonly found in mangrove areas. Feeds mainly on benthic algae (Ref. 3802). Known to have a home cave to which it retires at night or when danger threatens; makes use of the sun as an aid to locating the cave.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Scarus guacamaia is relatively widely distributed in the western Atlantic from Bermuda through south Florida, the Bahamas and the Caribbean to Venezuela.

There are dubious records from Brazil (Floeter et al. 2005) which are based on few specimens from museums and literature records. Although Ferreira et al. (2005) suggest that S. guacamaia is locally extinct, this species is confirmed as a vagrant along the Brazilian coast.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Bermuda, Florida (USA), and the Bahamas to Argentina; absent in the northern Gulf of Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This fish occurs in the western Atlantic, from Florida, Bermuda and the Bahamas to Argentina (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

120 cm TL (male/unsexed; (Ref. 7251)); max. published weight: 20.0 kg (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Fins dull orange with tongues of green extending into the dorsal and anal; margins of median fins blue; dental plates blue-green. There appears to be no obvious difference in color with sex (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Scarus guacamaia is the largest parrotfish in the Atlantic (Dorenbosch et al. 2006, Bellwood and Choat 2011) reaching a maximum size of 1.2 m (Choat et al. 2006) and a maximum age of 16 years (J.H. Choat pers comm. 2012). This species recruits primarily to mangroves (Mumby et al. 2004, Dorenbosch et al. 2006, Mumby and Hastings 2008, Bellwood and Choat 2011), and although it is suggested to be functionally dependent on mangroves, juveniles have been collected on rocks in Bermuda and adults have been found on isolated rocky islands 30–50 km from the nearest mangroves off the coast of Venezuela (Robertson pers comm. 2012). This species therefore appears to recruit to a variety of habitats. Scarus guacamaia is classified as a detritivore, with detritus/bacterial complexes and meiofauna as the primary food items. It also feeds on sponges (Dunlap and Pawlik 1998) and feeds more similarly to Sparisoma spp. particularly Sparisoma viride, than to other Scarus spp. (Burkepile and Hay 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 3 - 25 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 74 specimens in 1 taxon.
Water temperature and chemistry ranges based on 57 samples.

Environmental ranges
  Depth range (m): 0.5 - 12.8
  Temperature range (°C): 26.401 - 28.067
  Nitrate (umol/L): 0.435 - 3.505
  Salinity (PPS): 34.217 - 37.096
  Oxygen (ml/l): 4.390 - 4.706
  Phosphate (umol/l): 0.046 - 0.214
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.5 - 12.8

Temperature range (°C): 26.401 - 28.067

Nitrate (umol/L): 0.435 - 3.505

Salinity (PPS): 34.217 - 37.096

Oxygen (ml/l): 4.390 - 4.706

Phosphate (umol/l): 0.046 - 0.214

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 25m.
From 3 to 25 meters.

Habitat: reef-associated. Inhabits coral reefs. Known to have a home cave to which it retires at night or when danger threatens; makes use of the sun as an aid to locating the cave. Young are commonly found in mangrove areas. Feeds mainly on benthic algae (Ref. 3802).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated with coral reefs at depths of 3 to 25 metres (2). At night, rainbow parrotfish retreat into crevices (2). Juveniles tend to occur in mangroves adjacent to the reef. The mangroves act as important nursery areas and provide food-rich and predator free safe-havens for the growing young (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits reef areas. Is known to have a cave where it retires at night or it retreats to when endangered. Juveniles usually occur in mangrove areas (Ref. 3802).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scarus guacamaia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GCATAGTAGGCACTGCCCTAAGCCTTCTCATCCGAGCTGAATTAAGTCAACCCGGGGCCCTTCTCGGAGACGACCAGATTTATAATGTTATCGTTACAGCTCATGCGTTTGTAATGATCTTTTTTATAGTCATGCCTATCATGATCGGAGGCTTCGGGAACTGACTCATCCCACTCATGATCGGAGCGCCCGACATGGCCTTCCCTCGAATGAACAATATGAGCTTCTGACTTCTCCCCCCCTCCTTCCTCCTATTGCTCGCCTCCTCTGGCGTAGAAGCAGGGGCAGGTACCGGATGAACCGTTTACCCCCCTCTAGCAGGGAATCTTGCACACGCAGGTGCATCCGTCGACCTAACAATTTTCTCCCTTCATCTAGCAGGGATTTCTTCTATCCTAGGAGCAATTAACTTTATTACAACGATTGTTAACATAAAACCGCCTGCCATCTCTCAATACCAGACCCCCCTGTTTGTGTGAGCCGTTCTAATTACCGCCGTACTTCTTCTCCTCTCACTCCCTGTCCTCGCTGCAGGAATCACAATGCTTCTTACAGATCGAAATCTAAACACTACTTTCTTTGACCCTGCGGGCGGGGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Scarus guacamaia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Choat, J.H., Feitosa, C., Ferreira, C.E., Gaspar, A.L., Padovani-Ferreira, B. & Rocha, L.A.

Reviewer/s
Robertson, R., Craig, M.T. & McIlwain, J.

Contributor/s
Raynal, M.

Justification
Scarus guacamaia is the largest parrotfish in the Atlantic, reaching a maximum size in excess of 100 cm. It is relatively widespread in the western Atlantic from Bermuda through south Florida, the Bahamas and the Caribbean to Venezuela. It is naturally rare, a characteristic that is shared by other large-bodied labrids. It achieves high densities only in areas that are protected from exploitation and habitat degradation, with highest densities recorded in areas that have long been protected from exploitation (e.g., Bermuda, Bonaire and Los Roques). There have been significant decreases in species densities recorded over a gradient of fishing pressure, human densities and presence or absence of species protection through marine reserves. Densities of large-bodied parrotfish are 10-fold lower in areas where fishing is present than in areas where fishing is restricted (Debrot et al. 2008). Scarus guacamaia has experienced significant historical declines. In most of its range, this species is still fished, but given its current and natural rarity it is not often caught. This species is also threatened by the continued loss of coral reef and mangrove habitat from coastal development and extraction. Based on anecdotal information from Glovers Reef in the Caribbean (D. Wesby pers comm 2009), S. guacamaia has undergone local extinction in the past 30 years. Schools of this parrotfish were commonly observed in the 1960s when several of the islands had well-developed mangrove habitats (Mumby et al. 2004). This species appears to be uncommon elsewhere in its range.

Scarus guacamaia is usually associated with shallow waters and in reefs with extensive sheltered lagoonal/backreef areas. There are a number of parallels with Bolbometopon muricatum, the largest parrotfish in the in the Indo-Pacific, currently listed as Vulnerable on the IUCN Red List of Threatened Species. Intrinsic life history characteristics such as large size, natural rarity and shallow foraging areas render them particularly susceptible to overfishing (particularly spearfishing). Both species recruit into very shallow water, sheltered reef and mangrove sites that are increasingly impacted by habitat modification and degradation. S. guacamaia is experiencing > 30% decline and destruction of coral reef habitat which makes up 7% of its range and is exposed to extensive mangrove deforestation in many parts of its distributional range. Unlike B. muricatum, which inhabits a wide oceanic basin and could find refuge on isolated oceanic islands in the Indo-Pacific, S. guacamaia inhabits a smaller oceanic habitat and may not have access to the types of refuge available for B. muricatum.

In summary, there are several biological features of major significance to population reductions of this species due to extrinsic threats: 1) natural rarity of S. guacamaia; 2) large size; 3) shallow depth range (to 30 m) and propensity to occupy, recruit and forage in shallow sites. In addition to the impacts of exploitation, this species utilizes habitats that are increasingly impacted and have experienced significant loss in the last 20–30 years. Although significant declines have been reported, the lack of adequate historical population data combined with the rarity of current sightings and subsequent difficulty in coordinating efforts to determine its current population size has resulted in the inability to effectively quantify population declines over time. Moreover, S. guacamaia appears to be conservation dependent with recorded densities highest only in areas where protection is present. It is therefore listed as Near Threatened at the very minimum because cessation of conservation measures could result in this species qualifying for one of the threatened categories within a period of five years. We recommend further monitoring of this species’ population and habitat status and a comprehensive analysis of the reproductive biology including gonadal studies to confirm estimates of size and age at first maturity, estimates of age and sex-specific growth rates, and mortality estimates. In addition, a more detailed analysis of demographic and abundance data is needed in order to predict population responses to varying rates of fishing pressure.

History
  • 2010
    Data Deficient
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Scarus guacamaia has experienced significant historical declines. In most of its range, this species is still fished, but given its current and natural rarity it is not often caught. This species is also threatened throughout its range from the continued loss of coral reef and mangrove habitat from coastal development and extraction. Based on anecdotal information from Glovers Reef in the Caribbean (D. Wesby pers comm 2009), S. guacamaia has undergone local extinction in the past 30 years. Schools of this parrotfish were commonly observed in the 1960s when several of the islands had well-developed mangrove habitats (Mumby et al. 2004). Within this species' range, aggregated parrotfish catch landings show an increase that began in 2000 with a spike in 2003 and a 27% decline since then (FAO 2012). The pattern in catch landings are concordant to the shift in target preference to herbivorous fishes and planktivores with the removal of the piscivores (Butler et al. 1993, Debrot et al. 2008, Mumby et al. 2012).

Scarus guacamaia is naturally rare, a characteristic that is shared by other large labrids (Choat et al. 2006). However, it achieves relatively high densities in protected areas; for example, ~16 individuals/10,000 m² were observed in Bonaire, where it has been protected since 1979 (J.H. Choat pers comm. 2012) and 9.30 ± 3.79 ind/1,000 m² were recorded in Los Roques, where fishing is restricted (Debrot et al. 2008). In comparison, densities of S. guacamaia and other big-bodied parrotfishes at four localities in the Caribbean open to fishing were 10-fold lower than those within the Los Roques marine reserve, and were absent in Barbados where there was an extensive trap fishery for reef fishes and where parrotfishes are prized components of the reef fishery (Debrot et al. 2008). In Las Aves archipelago, an uninhabited area with an uncontrolled fishery targeting piscivorous reef fishes, only 0.4 individuals/10,000 m² were recorded for this species, while 15–16 individuals/10,000 m² were recorded for Scarus coelestinus, a large-bodied scarine (J.H. Choat pers comm. 2012). In Bermuda, where parrotfishes have been protected since 1978, this species was observed in big schools (15–30 individuals) (J.H. Choat pers. comm. 2012). Providing further support of the conservation dependency of this species, in a marine reserve in the Bahamas, the Exuma Cays Land and Sea Park, protection has resulted in an increase in total biomass inside the reserves for large-bodied parrotfishes such as Scarus vetula, although S. guacamaia was not reported in this study (Mumby 2006). This species appears to be uncommon elsewhere in its range (San Blas, Lee Stocking Island, Bahamas, Barbados, Belize, Curacao, St. Croix, St. Thomas, Jamaica and Margarita Island). and at a number of locations only small individuals were seen but none were recorded in counts (J.H. Choat pers comm. 2012).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Scarus guacamaia is usually associated with shallow waters and in reefs with extensive sheltered lagoonal/backreef areas (J.H. Choat pers comm. 2012). There are a number of parallels with Bolbometopon muricatum, the largest parrotfish in the Indo-Pacific, currently listed as Vulnerable on the IUCN Red List of Threatened Species. Intrinsic life history characteristics such as large size, natural rarity and shallow foraging areas render both species particularly susceptible to overfishing (particularly spearfishing). In addition, both species recruit into very shallow water, sheltered reef and mangrove sites that are increasingly impacted by habitat modification and degradation. Unlike B. muricatum, which inhabits a wide oceanic basin and could find refuge on isolated oceanic islands in the Indo-Pacific, S. guacamaia inhabits a smaller oceanic habitat and may not have access to the types of refuge available for B. muricatum.

More than 30% (37%) of coral reef habitat within the distributional range of S. guacamaia has been destroyed or is declining; this coral reef habitat makes up 7% of the species' range (Comeros-Raynal in prep.). In addition, the Caribbean region has the second highest mangrove area loss relative to other global regions with ~24% of mangrove area lost over the past 25 years (FAO 2007, Polidoro et al. 2010). The greatest rate of mangrove deforestation is occurring in the Americas (2,251 km²/year) and exceeds that of tropical rainforests (Mumby et al. 2004).

Parrotfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reefs, while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. Although the majority of the parrotfishes occur in mixed habitat (primarily inhabiting seagrass beds, mangroves, and rocky reefs) approximately 78% of these mixed habitat species are experiencing greater than 30% loss of coral reef area and habitat quality across their distributions. Of those species that occur exclusively in coral reef habitat, more than 80% are experiencing a greater than 30% of coral reef loss and degradation across their distributions. However, more research is needed to understand the long-term effects of habitat loss and degradation on these species populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that depend on live coral reefs for food and shelter especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats. Furthermore, coral reef loss and declining habitat conditions are particularly worrying for some corallivorous excavating parrotfishes that play major roles in reef dynamics and sedimentation (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In areas where adult coral reef habitat is connected to mangrove nursery habitat, removal of the mangroves has resulted in the local extinction of rainbow parrotfish (3). The current rate of destruction of mangroves, which is greater than that of tropical rainforest, will have a serious effect on adjacent reef communities (3). There are also known cases of deaths caused by poisoning (2). Further threats facing reef ecosystems include pollution, global warming, over-fishing and coastal development (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is found in a number of marine reserves in parts of its range. Furthermore, in Bermuda all species of parrotfishes are protected under the Fisheries (Protected Species) Order 1978. In addition, there have been recent protective measures put in place for parrotfishes in Belize, wherein the fishing of grazers, defined as any scarinae species and Acanthuridae species, is prohibited. In the Turks and Caicos, the fishing and selling of any species of parrotfish is prohibited, and the Caribbean Management Council, which comprises the Commonwealth of Puerto Rico and United States Virgin Islands, has prohibited the harvest and possession of Midnight Parrotfish (Scarus coelestinus), Blue Parrotfish (Scarus coeruleus), and S. guacamaia and reduced parrotfish harvest in St. Croix. In Bonaire, a recent law (instated in 2010) was passed banning the harvesting of parrotfish (Steneck et al. 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

It is clear that the habitat of this spectacular parrotfish, classified as globally Vulnerable by the IUCN Red List, is facing a huge range of threats. A number of reef reserves have been established in which fishing and other human pressures are prevented (5). The current rate of mangrove removal is a great threat to the survival of this and many other reef species (3). Hopefully, now that the importance of mangroves to reef communities has been recognised, steps can be taken to try to limit their hitherto wanton destruction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rainbow parrotfish

The rainbow parrotfish (Scarus guacamaia) is a species of fish in the Scaridae family. Among the largest members of this family (the largest in the Atlantic), it reaches 1.2 m (3.9 ft) in length. It is found at coral reefs, mangroves and sea grass beds in the Caribbean and near Bermuda.[2] It was formerly classified as vulnerable due to overfishing and habitat loss, but because the presently available data do not allow an estimate of the population decline, it is now considered near threatened by the IUCN.[2] It is relatively rare in most of its range, but more common in Bermuda.[2]

References[edit]

  1. ^ Choat, J.H., Feitosa, C., Ferreira, C.E., Gaspar, A.L., Padovani-Ferreira, B. & Rocha, L.A. 2012. Scarus guacamaia. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. <www.iucnredlist.org>. Downloaded on 27 October 2012.
  2. ^ a b c Ferreira, C.E., Ferreira, B., Rocha, L.A., Gaspar, A.L., Feitosa, C. & Choat, J.H. (2008). "Scarus guacamaia". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. Retrieved 18 May 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!