Barcode data: Lipotes vexillifer
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GBMA0379-06|AY789529|Lipotes vexillifer| AACCGCTGATTATTCTCAACCAATCATAAAGATATTGGCACTTTATATTTACTATTCGGTGCCTGAGCAGGGATAGTAGGTACAGGTTTA---AGCCTACTAATCCGTGCTGAATTAGGTCAACCTGGCACACTCATCGGAGAC---GACCAAATTTACAATGTCTTAGTAACAGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGTTTCGGAAACTGACTAGTTCCCCTAATA---ATTGGAGCACCTGATATAGCCTTTCCTCGCCTAAACAATATAAGCTTTTGACTACTTCCCCCCTCATTCCTCCTACTAATAGCATCTTCAGTAATTGAAGCAGGTACAGGCACAGGTTGAACTGTATATCCTCCTTTAGCTGGAAATCTAGCACATGCAGGAGCTTCAGTAGATCTT---ACCATTTTCTCCCTACATCTAGCCGGTGCATCCTCAATCCTCGGAGCCATTAACTTTATCACAACCATCATTAACATAAAACCTCCCGCCATAACTCAGTATCAAACACCCTTATTCGTATGATCAGTCCTAGTCACAGCAGTACTTCTACTACTATCATTACCTGTCCTAGCAGCC---GGAATTACAATACTATTAACAGACCGAAATCTAAATACAACCTTTTTCGACCCCGCAGGGGGAGGCGACCCAATTCTATATCAACATCTTTTCTGATTCTTCGGCCATCCCGAAGTATATATCTTAATCTTACCTGGCTTCGGAATAATTTCACATATCGTAACCTATTACTCAGGAAAAAAA---GAACCTTTCGGATACATAGGAATAGTTTGGGCTATAATCTCAATCGGATTCCTAGGCTTTATCGTGTGAGCTCATCATATATTTACAGTCGGAATAG
-- end --
-- end --
Download FASTA File
Latest updates
Source information
Some rights reserved
© Barcode of Life Data Systems
View source
Supplier:
Barcode of Life Data Systems (BOLD)
Compiler: Sujeevan Ratnasingham
Compiler: Paul D.N. Hebert
