Barcode data: Pelodiscus sinensis
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GBGC3828-07|AY962573|Pelodiscus sinensis| ACCCGTTGATTATTTTCTACTAATCATAAAGATATCGGCACCCTTTACTTAATTTTCGGTGCCTGAGCAGGTATAGTTGGCACAGCCTTA---AGCTTATTAATCCGAGCAGAACTAAGTCAACCTGGCACTCTTTTAGGGGAC---GACCAGATTTATAATGTAATTGCTACAGCACATGCTTTTGTCATGATCTTCTTTATAGTCATACCTGTAATAATTGGGGGATTCGGTAACTGACTTGTACCCTTAATA---ATTGGAGCCCCAGACATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTACTACCCCCCTCATTACTACTTCTCCTAGCCTCATCAGGCATTGAAACAGGAGCAGGAACTGGCTGAACCGTTTATCCCCCATTAGCTAGCAACCTAGCCCATGTGGGCGCATCAGTAGACTTA---ACTATTTTCTCCTTACATCTAGCTGGAGTATCTTCAATCCTTGGGGCTATCAATTTTATTACTACAGCTATTAATATAAAATCCCCAACAATATCACAATACCAAACTCCCTTATTCGTTTGATCAGTAGTTATTACAGCCGTACTACTATTACTTTCACTACCAGTGTTAGCCGCA---GGCATTACAATATTACTCACAGATCGAAACCTGAATACTACCTTTTTTGATCCTTCTGGGGGAGGAGATCCTATCCTATATCAACATTTATTCTGATTCTTCGGTCACCCAGAAGTTTATATCCTCATCCTCCCTGGGTTTGGCATAATCTCCCATGTAGTAACGTACTATGCTAATAAAAAA---GAACCATTCGGCTATATGGGAATAGTATGAGCAATAATATCAATTGGTTTCCTAGGATTCATTGTATGGGCCCATCATATATTCACTGTAGGAATAG
-- end --
-- end --
Download FASTA File
Latest updates
In the latest article
-
Trusted
Pelodiscus sinensis
This article is unpublished.
Appears under "Molecular Biology"
Source information
Some rights reserved
© Barcode of Life Data Systems
View source
Supplier:
Barcode of Life Data Systems (BOLD)
Compiler: Sujeevan Ratnasingham
Compiler: Paul D.N. Hebert
Revisions
- 2013-05-03 08:50:37 UTC
- 2012-08-16 05:00:58 UTC
- 2012-06-08 07:39:43 UTC
- 2011-06-30 13:34:13 UTC
- 2011-01-17 09:38:28 UTC
