Barcode data: Spheniscus magellanicus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 41 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 41 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
BROMB036-06|MM 5|Spheniscus magellanicus| AACCGATGATTATTCTCAACCAACCACAAAGATATCGGCACCCTTTACCTAATCTTCGGCGCATGAGCAGGCATAGCCGGAACCGCCCTC---AGCCTGCTCATCCGCGCAGAACTCGGTCAACCCGGAACCCTCCTAGGAGAC---GACCAGATCTACAATGTAATTGTTACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGATTTGGAAACTGACTAGTCCCACTTATA---ATCGGCGCCCCCGACATAGCATTTCCCCGCATAAATAACATAAGCTTTTGACTACTACCTCCCTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCCGGCACAGGATGAACCGTATACCCACCATTAGCAGGCAACCTAGCCCATGCCGGCGCATCAGTAGACCTA---GCCATTTTTTCACTCCACCTAGCAGGAATCTCCTCCATCCTAGGAGCAATCAACTTCATCACCACCGCCACTAACATAAAACCCCCAGCCCTATCACAATACCAAACCCCCCTGTTCGTATGATCCGTCCTTATCACAGCTGTCCTCCTACTACTCTCACTTCCCGTACTTGCTGCC---GGCATCACCATGCTACTAACAGACCGAAACCTAAACACCACCTTCTTCGATCCAGCTGGAGGGGGAGACCCAATCCTATACCAGCACCTCTTCTGATTCTTTGGTCACCCAGAAGTCTACATCCTAATTCTACCAGGCTTCGGAATCATCTCTCACGTAGTAGCATACTATGCAGGCAAAAAG---GAACCCTTTGGCTACATAGGCATAGTATGAGCAATACTGTCCATCGGATTCCTCGGCTTTATCGTATGAGCTCACCACATATTCACAGTCGGTATAG
-- end --
-- end --
Download FASTA File
