Barcode data
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GBCPH424-07|AB266515|Vampyroteuthis infernalis| ATGCGATGATTATTCTCAACAAATCATAAAGATATTGGAACTTTATATTTTATTTTAGGTATTTGATCAGGTTTATTAGGAACATCTTTA---AGTTTAATAATTCGAACAGAGCTTGGACAACCAGGATCCTTATTAAATGAT---GATCAATTATATAATGTAATTGTAACAGCTCATGCTTTCGTTATAATTTTTTTTTTAGTAATACCTGTTATAATTGGGGGTTTTGGTAATTGACTTATCCCTTTAATA---TTAGGAGCACCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTATTACCTCCATCTCTTACTTTATTATTAACCTCTGCTACAATTGAAAGAGGAGTTGGAACAGGATGAACTGTATATCCACCTCTTGCTAGAAATCTAGCACATACCGGGCCCTCTGTAGATTTA---GCTATTTTTTCACTTCATCTTGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACCACTATTATAAATATACGTTGACAAGGAATATATATAGAACGATTACCTTTATTTGTATGGTCAATTCTAATTACAACAATTTTATTACTTTTATCTATGCCTATTTTAGCTGGA---GCTATTACAATATTATTAACTGATCGAAATTTCAATACTACCTTTTTTGATCCAAGAGGTGGAGGAGACCCTATCTTATACCAACATTTATTTTGATTTTTTGGCCACCCAGAAGTATATATTTTAATTCTACCAGGATTTGGAATTATTTCTCATATTGTATCTCATTACTCTTTAAAAAAA---GAAGTTTTTGGAATATTAGGTATAATTTATGCTATAATATCTATTGGTTTACTGGGTTTTATTGTTTGAGCTCATCATATATTTACAGTAGGAATAG
-- end --
-- end --
Download FASTA File
